Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0001566 | |||
Gene | MAPK9 | Organism | Human |
Genome Locus | chr5:179688683-179707608:- | Build | hg19 |
Disease | Gliomas | ICD-10 | Malignant neoplasm of Brain, unspecified (C71.9) |
DBLink | Link to database | PMID | 28236760 |
Experimental Method | |||
Sample Type | Brain Tissues | Comparison | Five Glioblastoma Multiforme (GBM) and five normal brain specimens |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CTTTGTGGTATTAAACATCTGC ReverseTCACATTTACTGTCGCTCA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Zhu, J, Ye, J, Zhang, L, Xia, L, Hu, H, Jiang, H, Wan, Z, Sheng, F, Ma, Y, Li, W, Qian, J, Luo, C (2017). Differential Expression of Circular RNAs in Glioblastoma Multiforme and Its Correlation with Prognosis. Transl Oncol, 10, 2:271-279. |